Brd3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAACAGTAAAAACTTAGA and TGTTAAGAGATTTGTCATGG, which resulted in a 352 bp deletion beginning at Chromosome 2 position 27,462,338 bp and ending after 27,462,689 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283892 (exon 4) and 204 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 69 amino acids later. (J:188991)