This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCCACACTCAAGCACCACC and TTGCTGCACAAGCGGCTCCA, which resulted in a 1010 bp deletion beginning at Chromosome 7 position 51,861,249 bp and ending after 51,862,258 bp (GRCm38/mm10). This mutation deletes 1010 bp of ENSMUSE00000879688 (exon 1) including the start site and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count