This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCCACCTAGGGAAGGTGA and ACCATTCCCGTGGGGCCGCG, which resulted in a 5368 bp deletion beginning at Chromosome 8 position 57,482,549 bp and ending after 57,487,916 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000211137, ENSMUSE00000211139, ENSMUSE00000211140, ENSMUSE00000211138 (exons 1-4) and 4190 bp of flanking intronic sequence including the transcription start site and is predicted to generate a null allele. (J:188991)