This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGTTCGCTGTTTCTCAG and TTAAAAATACTTGTGCATAG, which resulted in a 2665 bp deletion beginning at Chromosome 18 position 36,997,816 bp and ending after 37,000,480 bp (GRCm38/mm10). This mutation deletes 2665 bp from ENSMUSE00000703749 (exon 1) including the splice acceptor, start site and donor and is predicted to a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count