Skor1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTACTTCCTGCATTAAAA and AGATTATCCCAAATCCACTA, which resulted in a 345 bp deletion beginning at Chromosome 9 position 63,143,267 bp and ending after 63,143,611 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000342989 (exon 3) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 768 and early truncation 92 amino acids later. There is a 2 bp insertion (AC) at the deletion site. (J:188991)