Ces2c^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTACAGAAAACTAACCCAG and GGAATAACATGGATATACTA, which resulted in a 469 bp deletion beginning at Chromosome 8 position 104,847,963 bp and ending after 104,848,431 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220643 (exon 2) and 258 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later. (J:188991)