This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTTTCAAACTAATCATAG and CGTCCTGTGGACAAAGAGGG, which resulted in a 12,878 bp deletion beginning at Chromosome 17 position 83,501,735 bp and ending after 83,514,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341244, ENSMUSE00000140226, ENSMUSE00001454054 (exons 1,2,3) and 465 bp of flanking intronic sequence including the splice acceptor start site and donor and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count