Trnp1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACGGCGCGGCCAGGGCC and CAGGCGCTGATTCGGCAGCC, which resulted in a 649 bp deletion beginning at Chromosome 4 position 133,497,822 bp and ending after 133,498,470 bp (GRCm38/mm10). This mutation deletes 649 bp from ENSMUSE00000775605 (exon 1) including the start sequence and is predicted to generate a null allele. (J:188991)