This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTAGTTAGGCCTTCCCTA and AACCCCTTATTCATCAGCGT, which resulted in a 1255 bp deletion beginning at Chromosome 2 position 163,086,776 bp and ending after 163,088,030 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000597815 (exon 1) and 433 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele. There is a 3 bp insertion (TTA) 5 bp after the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count