This allele from project TCPR1495 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGCTATTTGGTGGCTAATT and GTATGAGGTGTGTTTATCGG targeting a critical region. This resulted in a 2130-bp del Chr18: 37412012-37414141 (p.N47_S757del_insT) (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count