Tmem179^em2(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATACGGTGGGGCCATGCCG and TCAACATCGGAACATTTGCA, which resulted in a 1752 bp deletion beginning at Chromosome 12 position 112,503,097 bp and ending after 112,504,848 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435049 and ENSMUSE00000435046 (exons 2 and 3) and 1535 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 18 amino acids later. There is a 3 bp insertion (CTA) at the deletion site. (J:188991)