Cstad^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCAGCTGAGCCATAACGG and TCATGAGTTGGTACAGCCAG, which resulted in a 228 bp deletion beginning at Chromosome 2 position 30,608,209 bp and ending after 30,608,436 bp (GRCm38/mm10). This mutation deletes 228 bp from ENSMUSE00000662814 (exon 2) and is predicted to cause a change of amino acid sequence after residue 17 deletes 76 amino acids and remains in frame for the last 11 amino acids before the stop colon. (J:188991)