Tars3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAAATATACAGTCAGTGGT and TGTGCTTCAAACAAACAGGT, which resulted in a 472 bp deletion beginning at Chromosome 7 position 65,647,301 bp and ending after 65,647,772 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273396 (exon 3) and 281 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 113 followed by a stop codon. (J:188991)