Vps36^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGAGCGCTGTTCCCTAGG and AAATACATACGGTAAGAGCA, which resulted in a 302 bp deletion beginning at Chromosome 8 position 22,202,206 bp and ending after 22,202,507 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000209862 (exon 3) and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 12 amino acids later. (J:188991)