Gtf2h3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCATGGCAAAGAAGCTGAG and ATACACCAATTCCCACCACA, which resulted in a 695 bp deletion beginning at Chromosome 5 position 124,583,657 bp and ending after 124,584,351 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266779 and ENSMUSE00001246016 (exons 3 and 4) and 421 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 25 amino acids later. (J:188991)