This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTGCGGAGGTCTTTCATA and GAAACTAACTATAATGGTCT, which resulted in a 629 bp deletion beginning at Chromosome X position 106,709,117 bp and ending after 106,709,745 bp (GRCm38/mm10). This mutation deletes 629 bp from ENSMUSE00000654025 (exon 4) and is predicted to cause a change of amino acid sequence at residue 1 followed by a stop. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count