This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGGTTGAT and GGCAAAAGGCTGGGGCTGAC, which resulted in a 348 bp deletion beginning at Chromosome 3 position 6,620,010 bp and ending after 6,620,357 bp (GRCm38/mm10). This mutation deletes 348 bp of ENSMUSE00000569619 (exon 1) and is predicted to cause a change of amino acid sequence after residue 11 for 1 amino acid then return to frame for 47 amino acids before termination. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count