This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGATCTGAAGGTGCTGAAAG and GTCTCTGGGTAACGGCGACA, which resulted in a 1826 bp deletion beginning at Chromosome 4 position 88,720,160 bp and ending after 88,721,985 bp (GRCm38/mm10). This mutation deletes 1826 bp of ENSMUSE00000603001 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 30 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count