Lysmd1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGAAAACAGTGTACTTGG and AGAAGTAACCAAAGTACCCG, which resulted in a 614 bp deletion beginning at Chromosome 3 position 95,137,456 bp and ending after 95,138,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000422932 (exon 2) and 252 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early truncation 2 amino acids later. (J:188991)