Jakmip2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAACGGGATATACGGAGGC and AGCAAAGAGGATTCGTGAGT, which resulted in a 444 bp deletion beginning at Chromosome 18 position 43,581,839 bp and ending after 43,582,282 bp (GRCm38/mm10). This mutation deletes 444 bp of ENSMUSE00000659470 (exon 1) and is predicted to cause a change of amino acid sequence after residue 59 and an immediate stop. There is a 1 bp (T) insertion at the deletion site. (J:188991)