Tmem144^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGTATCTGGGAGACAAGT and CCATTGCCTTACGCTCTTGA, which resulted in a 501 bp deletion beginning at Chromosome 3 position 79,833,679 bp and ending after 79,834,179 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000174648 (exon 4) and 401 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 78 and early truncation 15 amino acids later. (J:188991)