Yif1a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAGTCGAGAGGCGCACCG and TTAAAGTCACTGGCTCCAAG, which resulted in a 646 bp deletion beginning at Chromosome 19 position 5,091,215 bp and ending after 5,091,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145739 and ENSMUSE00000145750 (exons 5 and 6) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 1 amino acids later. (J:188991)