Plasmids encoding a signal guide RNA (TCGCGAAGTGTCGCCCGGAGTGG) were designed to introduce a 62 bp deletion in exon 1. This mutation results in a frameshift and a 38 amino acid product. No potential off-target sites are present. (J:300476)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count