This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTCATAGAAAGGTTATG and TCAATGAACCATCTGAACAG, which resulted in a 480 bp deletion beginning at Chromosome 19 position 8,797,208 bp and ending after 8,797,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621714 (exon 3) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 41 amino acids later. There is a single bp insertion A at the deletion site. (J:188991)