This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTCTAGTGCTGCACCACT and GGCTCAACTTGGGAACACAT, which resulted in a 940 bp deletion beginning at Chromosome 9 position 96,517,356 bp and ending after 96,518,295 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001318241 (exon 4) and 791 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 3 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count