This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTTACCACAAAGTCG AND GGTGAGGAATGATTTCAGAA, which resulted in a 1060 bp deletion beginning at Chromosome 3 position 88,420,282 bp and ending after 88,421,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980176 (exon 2) and 422 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 43 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count