Creg2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATTCATCTGAAAACGTGA and TATTCTGTCTGGAAGCTGAA, which resulted in a 575 bp deletion beginning at Chromosome 1 position 39,647,621 bp and ending after 39,648,195 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000356149 (exon 2) and 405 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 49 amino acids. (J:188991)