Scoc^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCTGGGAACAAGTGAG and ACTCTCCATGCTTTACTGCT, which resulted in a 3865 bp deletion beginning at Chromosome 8 position 83,434,286 bp and ending after 83,438,150 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001247660 through ENSMUSE00001393187 (exons 2-4) and 2163 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 16 amino acids later. (J:188991)