This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCAGACTGTCGAAGGCAG and CAAATGATCTGCATGCCCGT, which resulted in a 672 bp deletion beginning at Chromosome 12 position 108,980,296 bp and ending after 108,980,967 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000879483 (exon 4) and 524 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 265 and early truncation 15 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count