This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATTTAGGTAGAAAAAT and AGTTATAGTACTAAGCACAC, which resulted in a 458 bp deletion beginning at Chromosome 10 position 29,322,031 bp and ending after 29,322,488 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001307826 (exon 3) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 42 amino acids later. There is a 10 bp insertion (TTATAGTACT) at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count