This allele from project TCPR1408 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATGGAGGATGTACCAAACA targeting the 5' side and AGCAGAATACTCCTAGTAGA targeting the 3' side of a critical region. This resulted in a 635-bp del Chr5:147450462-47451096; 4-bp del Chr5: 147451260-147451263. The 635-bp deletion represents the Cas9-mediated deletion while the 4-bp deletion is likely a strain-specific polymorphism (GRCm38). (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count