Sptb^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATTGGGATACAGGAAGAG and CCCACCACACTTCAGAAATG, which resulted in a 1369 bp deletion beginning at Chromosome 12 position 76,620,406 bp and ending after 76,621,774 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000114246 (exon 14) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 599 and early truncation 7 amino acids later. There is a 2 bp insertion (AC) at the deletion site. (J:188991)