Klhl34^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGAGGCATCCCATAACA and TAAGGAGGTGAACAAGGCCT, which resulted in a 1657 bp deletion beginning at Chromosome X position 157,818,351 bp and ending after 157,820,007 bp (GRCm38/mm10). This mutation deletes 1572 bp of ENSMUSE00000543784 (exon 1) and 83 bp upstream of the ATG start and is predicted to generate a null allele. There is a 6 bp insertion TCCAGC at the deletion site. (J:188991)