Psip1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTTATCTCCAAACATAGG and GAGTTCACTCAGGTGTACTA, which resulted in a 359 bp deletion beginning at Chromosome 4 position 83,482,211 bp and ending after 83,482,569 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000316636 (exon 3) and 282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 14 amino acids later. (J:188991)