Clec16a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGAGTTGTGCTTGTTACT and GTGTCAAGCTAGTCCAAGCG, which resulted in a 274 bp deletion beginning at Chromosome 16 position 10,568,310 bp and ending after 10,568,583 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001011715 (exon 4) and 125 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 114 and early truncation 3 amino acids later. (J:188991)