Spg11^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCTAACTGCATAGCAAAG and CTTACCATCCTGTTACAGAA, which resulted in a 499 bp deletion beginning at Chromosome 2 position 122,111,622 bp and ending after 122,112,120 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001285422 (exon 4) and 306 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 218 and early truncation 23 amino acids later. (J:188991)