CRISPR/Cas9 technology using the upstream guide 5ATCATCTGACTGTTAGACGG3 and downstream guide 5ACTCGCTCTGCAATAAACAT3 sequences generated a 211-bp deletion which includes a part of the promoter, the first exon and intron, and most of the second exon. (J:279164)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count