This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCGTTATCTACCAGAAGA and GACAGTAGGGATTACAGCAA, which resulted in a 295 bp deletion beginning at Chromosome 6 position 38,387,467 bp and ending after 38,387,761 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000655532 (exon 4) and 180 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 78 and early truncation 23 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count