Topors^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGTAACTAACTGTTCACCC and GGTACTTCCCCAAAGGTAAA, which resulted in a 3749 bp deletion beginning at Chromosome 4 position 40,259,541 bp and ending after 40,263,289 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000345531 (exon 3) and 268 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 12 amino acids later. (J:188991)