Zfp518b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTCGGACATTAAATGGGG and CATGAACTTGAGCTACCTGG, which resulted in a 6658 bp deletion beginning at Chromosome 5 position 38,668,433 bp and ending after 38,675,090 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001363757 (exon 4) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele. There is a 6 bp insertion at the deletion site (CATGTG). (J:188991)