Tcea2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGGTCCCAAATAGCCATT and GGAGGTTTTCAGGCTGCAGG, which resulted in a 459 bp deletion beginning at Chromosome 2 position 181,683,416 bp and ending after 181,683,874 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001258127 (exon 3) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 66 amino acids later. There is an additional 10 bp deletion (GCTGCAGGAG) 22 bp after the 459 bp deletion. (J:188991)