1700030J22Rik^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, ACTTTGCTTTCTAGCACGTG and GTGAGGTCCTTCCCCAGCCA, which resulted in a 926 bp deletion beginning at Chromosome 8 position 116,971,225 bp and ending after 116,972,150 bp (GRCm38/mm10). This mutation deletes 926 bp of ENSMUSE00000425915 (exon 3) and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 6 amino acids later. (J:188991)