This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTCTTTTGGACTAAGCG and AAATGTAATTCCTTAAAAGG, which resulted in a 435 bp deletion beginning at Chromosome 10 position 128,462,848 bp and ending after 128,463,282 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000150241 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 21 amino acids later. (J:188991)