This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCATCTGACCCTAATGGAA and ATGCCATCGGATTAAAGAAG, which resulted in an 826 bp deletion beginning at Chromosome 2 position 25,966,411 bp and ending after 25,967,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264038 (exon 2) and 563 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 21 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count