Smarca2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGAAGAAATCATAATGC and ATTGATTTCCTACATCACGG, which resulted in a 267 bp deletion beginning at Chromosome 19 position 26,646,911 bp and ending after 26,647,177 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000146234 (exon 6) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 359 and early truncation 1 amino acids later. (J:188991)