This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAACATAGAGAGACTGTAG and ATTTGAATTCTGTACCATTA, which resulted in a 418 bp deletion beginning at Chromosome 6 position 41,355,213 bp and ending after 41,355,630 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001070396 (exon 2) and 258 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 13 and early truncation 4 amino acids later. (J:188991)