Sec31b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTCCAGCTTTACCACTGGA and AAGAATCAGTCTCAGCACCG, which resulted in a 697 bp deletion beginning at Chromosome 19 position 44,535,584 bp and ending after 44,536,280 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001259906 and ENSMUSE00001257432 (exons 4 and 5) and 405 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 48 amino acids later. (J:188991)