This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTGCCCAAGAGTCCACAG and CCATAAGCCCTAAGGTTTGA, which resulted in a 211 bp deletion beginning at Chromosome 13 position 30,974,433 bp and ending after 30,974,643 bp (GRCm38/mm10). This mutation deletes 211 bp of non-coding ENSMUSE00000431669 (exon 1) and is predicted to result in disruption of the regulatory build in this genome region. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count