Ykt6^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCACACTGTCCCCAACACAG and TGGATAGGAGAAGCAAGGCG, which resulted in a 248 bp deletion beginning at Chromosome 11 position 5,959,240 bp and ending after 5,959,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000105087 (exon 2) and 165 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 19 amino acids later. (J:188991)