This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCCAACTGATTGTTCAAA and GGTCTGATATGCACAGACAC, which resulted in a 2408 bp deletion beginning at Chromosome X position 120,399,472 bp and ending after 120,401,879 bp (GRCm38/mm10). This mutation deletes 2408 bp from ENSMUSE00000435881 (exon 3) and is predicted to cause a change of amino acid sequence after residue 203 and early truncation 51 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count